Gene Species Chrom sgRNA PAM Type Validity PMID
UCA1 Homo sapiens chr19 AACAAGGCTGTTAATTCACT TGG CRISPRi High activity 28038452
UCA1 Homo sapiens chr19 AGGGGCAGCTTTATAGGGCT GGG CRISPRi High activity 28038452
UCA1 Homo sapiens chr19 GGTTTCCTTTTAGATGACGG AGG CRISPRko Experimental validated 26493208
UCA1 Homo sapiens chr19 TCTGAAAAGAGAGTCAGCGA AGG CRISPRko Experimental validated 26493208
UCA1 Homo sapiens chr19 GTGCATGGTGGAGAGATGAT GGG CRISPRko Experimental validated 25414344
UCA1 Homo sapiens chr19 TTCTGGAATGGTGAACCCAA TGG CRISPRko Experimental validated 25414344
XIST Homo sapiens chrX TGCAAAAGGGGTCTGAGAGT AGG CRISPRko High activity 26786668
XIST Homo sapiens chrX GCAGCGCTTTAAGAACTGAA GGG CRISPRi High activity 25307932
XIST Homo sapiens chrX GACTGAAGATCTCTCTGCACTT GGG CRISPRi High activity 25307932
XIST Homo sapiens chrX GCCATATTTCTTACTCTCTCG GGG CRISPRi High activity 25307932
AK170409 Mus musculus chrX GAAAAATTGGGTGTCTGGTT TGG CRISPRko Experimental validated 29051223
AK170409 Mus musculus chrX TTGACTTTAGATGTCGGTAA AGG CRISPRko Experimental validated 29051223
AK170409 Mus musculus chrX AGAGTATCTTCTCATAAGTA AGG CRISPRko Experimental validated 29051223
AK170409 Mus musculus chrX GCAGGAGTGATTGTATGAAG TGG CRISPRko Experimental validated 29051223
Bvht Mus musculus chr18 CGACCACCACCGCCTGCCAC AGG CRISPRko Experimental validated 27618485
Bvht Mus musculus chr18 GTTTGGGAGCCAGTGTCGTC AGG CRISPRko Experimental validated 27618485
Evx1as Mus musculus chr6 CATTTGAAAAGGCGGGGATT GGG CRISPRko Experimental validated 27226347
Evx1as Mus musculus chr6 CAGAGTCCGCCACGATTTTA CGG CRISPRko Experimental validated 27226347
Evx1as Mus musculus chr6 ATCCACTTGCGTTCGCCGAG TGG CRISPRko Experimental validated 27226347
Evx1as Mus musculus chr6 TGGGCCTCGCTCGAATGGGG AGG CRISPRko Experimental validated 27226347
Evx1as Mus musculus chr6 CACACCTGGTACTGGCATAC TGG CRISPRko Experimental validated 27226347
Evx1as Mus musculus chr6 TCATTAGAACACGCCGTTTG TGG CRISPRko Experimental validated 27226347
Gm26878 Mus musculus chr8 TGGCCTCTGGGTCGGGACCC TGG CRISPRko High activity 28405742
Gm26878 Mus musculus chr8 TTATGGACTCCGGACTAGAA AGG CRISPRko High activity 28405742
Haunt Mus musculus chr6 TAGAGGAACAATTGCTGCAT TGG CRISPRko High activity 26615201