All
Gene Species Chrom sgRNA PAM Type Validity PMID
AC004463.6 Homo sapiens chr22 CGTAGCTCTGGACTGCTGGG TGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 AAGTCTGTGCTGCCTTCCGG TGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 GGCCGCCCCCCGCTGGGTCG AGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 AGCCCAATCAATCTCGGACG AGG CRISPRko Experimental validated 27798563
AC004463.6 Homo sapiens chr22 GTCTCCCGGGCCCCGAGAGG AGG CRISPRko Experimental validated 27798563
AC004463.6 Homo sapiens chr22 CTGGTGGCAGTGACCGCGAG GGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 CTGGTGCGTCAGAATGGCCC AGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 CACGTGGAGGACGCTCAGGC AGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 CACAAAGGGGCCCTCGATAG CGG CRISPRko Experimental validated 27798563
AC004463.6 Homo sapiens chr22 TCTTCCCAGTAAATGGCCCG CGG CRISPRko Experimental validated 27798563
AC004463.6 Homo sapiens chr22 GTCAGGGTCATCGGTAGCGG CGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 GGGAACGCGATCCGACTCGG CGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 ACTTGGCTCGGGAACCCCCT GGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 GTCCCTCGGCATGTGAGCCC AGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 GTGTGAAGCAGCCTACAGTG TGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 CCGTGGAAGTAGGACAGGGC TGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 GGGACACGCAGGCCAGCTCT AGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 TCTGAGGACACTGCAGTAGG GGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 ACCCGAAGATCAGGGGCTGG TGG CRISPRko Experimental validated 27798563
AC004463.6 Homo sapiens chr22 CTCTTTCGGAAATGGTCCCC AGG CRISPRko Experimental validated 27798563
AC004463.6 Homo sapiens chr22 GCCCGCAGCGATCTGGAGTG CGG CRISPRko Experimental validated 27798563
AC004463.6 Homo sapiens chr22 CCCTATGGCCGGGTACTGAG CGG CRISPRko Experimental validated 27798563
AC004463.6 Homo sapiens chr22 GGTGGACGATGTGGCTGGGC CGG CRISPRko Experimental validated 27798563
AC004463.6 Homo sapiens chr22 CTATGGCCGGGTACTGAGCG GGG CRISPRko Experimental validated 27798563
AC004463.6 Homo sapiens chr22 GCGATGAAACCCGAAGATCA GGG CRISPRi Experimental validated 27798563