All
Gene Species Chrom sgRNA PAM Type Validity PMID
CYRANO Homo sapiens chr15 GCCCAGAGGCCAGTTTGCAG CGG CRISPRi Experimental validated 29887379
PCAT19 Homo sapiens chr19 GTAACGAGACCCTTAATCGC TGG CRISPRi;CRISPRa Experimental validated 30033362
PCAT19 Homo sapiens chr19 TTTCTCCACTAGCATTTCCA TGG CRISPRi;CRISPRa Experimental validated 30033362
PCAT19 Homo sapiens chr19 ACTGAGTGAAAAGAAAAGCC CGG CRISPRi;CRISPRa Experimental validated 30033362
PCAT19 Homo sapiens chr19 TGAGTGAAAAGAAAAGCCCG GGG CRISPRi;CRISPRa Experimental validated 30033362
PCAT19 Homo sapiens chr19 GGTAAAATGCCTCCACTCTCC AGG CRISPRa Experimental validated 30033362
PCAT19 Homo sapiens chr19 GGGAAGGCAGCTGCTTCTAAT TGG CRISPRa Experimental validated 30033362
PCAT19 Homo sapiens chr19 CTGAGTGAAAAGAAAAGCCCG GGG CRISPRa Experimental validated 30033362
AC004463.6 Homo sapiens chr22 GAGACACAACAGAAACCTAG AGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 ATCCCTGCTTTGCCGAAAGG TGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 GATGGAACACCACAAAATGC TGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 ACGAGGGGTCGAGTCAGTGG CGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 GGTACTGAGCGGGGCCCGGG TGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 TTCAGGAGATGACACTCCTG TGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 GCGGGGTGGCCTCGACCCAG CGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 GGGTCTCCAAGCTAGTCTGC AGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 GGGATTCTGAAGCCATTAGG TGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 ATTAAGTGGGCGTTGGGTGG TGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 CCCCAGCTGTCACCCGGCCA AGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 GGTGTGTTGACAAGGCCTAG GGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 TCGGCAAAGCAGGGATGCCC AGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 AGGGCGTCAAGGAGCCAGGG TGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 CGAGTCTCCCGGGCCCCGAG AGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 GGCTGCTTGGAGGCCCCTCG CGG CRISPRko Partial validated 27798563
AC004463.6 Homo sapiens chr22 GACACAGTTAGACAACCGGA TGG CRISPRko Partial validated 27798563