All
Gene Species Chrom sgRNA PAM Type Validity PMID
NEAT1 Homo sapiens chr11 CGTCCAGCACGGCTGGGCCG GGG CRISPRko Partial validated 27798563
NEAT1 Homo sapiens chr11 TTACTAGGAGAAGGGAATGG TGG CRISPRko Partial validated 27798563
NEAT1 Homo sapiens chr11 GGCCCAGCCACGCATTCCAC AGG CRISPRko Partial validated 27798563
NEAT1 Homo sapiens chr11 GCGCCAGGATTCCCAGTGGG TGG CRISPRko Partial validated 27798563
NEAT1 Homo sapiens chr11 CCTAGCATGTTTGACAGGCG GGG CRISPRko Partial validated 27798563
NEAT1 Homo sapiens chr11 GTGTGGCTAGCTCTTCCCAC TGG CRISPRko Partial validated 27798563
NEAT1 Homo sapiens chr11 GGTTAGCACAGGCGAAAGTG TGG CRISPRko Partial validated 27798563
Lncenc1 Mus musculus chr13 GAGCCAATCTCTAGGCAAGT AGG CRISPRko Experimental validated 30174313
Lncenc1 Mus musculus chr13 GTATGACAAATGCTTATTGA AGG CRISPRko Experimental validated 30174313
Lncenc1 Mus musculus chr13 GTGCTTTTGTGTTATCCCGG TGG CRISPRko Experimental validated 30174313
Lncenc1 Mus musculus chr13 GGTCCATTATGTAACCACCT TGG CRISPRko Experimental validated 30174313
BGLT3 Homo sapiens chr11 TAGATTGTCTTTCGCTCTGA TGG CRISPRko;CRISPRi Experimental validated 30150205
BGLT3 Homo sapiens chr11 AGAACATCTAATAGTGTTGG GGG CRISPRko Experimental validated 30150205
CYTOR Homo sapiens chr2 GGGCTCAGGCACCGCTTGTC TGG CRISPRko Experimental validated 30064438
CYTOR Homo sapiens chr2 TTAGTCGTGTGTACATCATT GGG CRISPRko Experimental validated 30064438
CYTOR Homo sapiens chr2 ATCTTCACAGCACAGTTCCT GGG CRISPRko Experimental validated 30064438
CYTOR Homo sapiens chr2 GAGGCCTCTGCATTTGCGGG TGG CRISPRko Experimental validated 30064438
CYTOR Homo sapiens chr2 ATTTTGGTCATGGGCTGGTC TGG CRISPRko Experimental validated 30064438
CYTOR Homo sapiens chr2 TGTTGCCCGCCGATCACAGC CGG CRISPRko Experimental validated 30064438
YIYA Homo sapiens chr1 GGAATCTAGATGAGAAGTGA TGG CRISPRko Experimental validated 29967256
YIYA Homo sapiens chr1 GTGAGGGAGAAGTGCTTCAG AGG CRISPRko Experimental validated 29967256
tie-1as Danio rerio chr6 CATGAGTTGTTTTCTTCAGT TGG CRISPRi Experimental validated 29724820
tie-1as Danio rerio chr6 GAGGTTGACTTGCGTTTTCT GGG CRISPRi Experimental validated 29724820
tie-1as Danio rerio chr6 CACAAAAGCTCAATTAGCAT AGG CRISPRi Experimental validated 29724820
Cyrano Mus musculus chr2 CATCTCAAAATGGAAGACAT TGG CRISPRi Experimental validated 29887379