All
Gene Species Chrom sgRNA PAM Type Validity PMID
NEAT1 Homo sapiens chr11 AATGGCTTTTGGGGTACAAA TGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 GGCACTGGACATAAGCCCCC TGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 CCACCTGGAAAATAAAGCGT TGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 CATTTAAACCTTCTTCCCCG TGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 GTACACTACTGACAAACGGG TGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 ACTTTATTTGTGCTGTAAAG GGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 TACGCGGGGAAACGTGCCAC TGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 GGCGGGTCGTCCTAACTAGC AGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 GCAAAACCTTACACCCCAAG AGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 TACCACTTAGAACTCTAACC AGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 GAGGGTGGCTGCACAGTCGA GGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 GCAAAACCTGAGTGCGGCCA TGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 GGATATCATATACTCACAAC AGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 CACATGGTTAGTGGTCAAAG AGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 GGGAGGCGCGGAGCCGCCGC AGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 CCTGATGTTAGTGGCTATGT AGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 TCATATATGGAGCGTCGTAG AGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 GAACTGAACTTAGCTCGACG GGG CRISPRko Partial validated 27798563
NEAT1 Homo sapiens chr11 AAGGAATCCACAGCTGACGG TGG CRISPRko Partial validated 27798563
NEAT1 Homo sapiens chr11 GTGTTGTGCTAAACGCTGGG AGG CRISPRko Partial validated 27798563
NEAT1 Homo sapiens chr11 CTTTGCAAACCTAGGGGTGG AGG CRISPRko Partial validated 27798563
NEAT1 Homo sapiens chr11 GGTCCTCTCCTCATGTGCCG TGG CRISPRko Partial validated 27798563
NEAT1 Homo sapiens chr11 GGTGGGGGATCATGACCTGA AGG CRISPRko Partial validated 27798563
NEAT1 Homo sapiens chr11 AATTGGTAAAGTAATACCAA TGG CRISPRko Partial validated 27798563
NEAT1 Homo sapiens chr11 CTAGGGGCCGCTGGAGGTGC AGG CRISPRko Partial validated 27798563