All
Gene Species Chrom sgRNA PAM Type Validity PMID
NEAT1 Homo sapiens chr11 ATTGCCTTCATAACGACTT TGG CRISPRko Experimental validated 28325845
NEAT1 Homo sapiens chr11 GCGACAGGGAGGGATGCGCGCC TGG CRISPRi Experimental validated 25307932
NEAT1 Homo sapiens chr11 GCGCGCCTGGGTGTAGTTGT GGG CRISPRi Experimental validated 25307932
NEAT1 Homo sapiens chr11 GAAGTGGCTAGCTCAGGGCTTC AGG CRISPRi Experimental validated 25307932
NEAT1 Homo sapiens chr11 GGAGCCGCCGGGGTCGCTTG AGG CRISPRko Experimental validated 30036787
NEAT1 Homo sapiens chr11 ATACACTGGGGTCCTTGCGT GGG CRISPRko Experimental validated 30036787
NEAT1 Homo sapiens chr11 CTGAGCGAGCCCGGGTGCGC TGG CRISPRko Experimental validated 30036787
NEAT1 Homo sapiens chr11 TATGTAATTTTCGCTCGGCC TGG CRISPRko Experimental validated 30036787
NEAT1 Homo sapiens chr11 ACGGACCCGCCGTGGGCCCA GGG CRISPRko Experimental validated 30036787
NEAT1 Homo sapiens chr11 GCTTGTGCCTCTGCTCGTGA AGG CRISPRko Experimental validated 30036787
NEAT1 Homo sapiens chr11 AGAGGCCTTCCCGCTGAGGC TGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 TCCGACTTCATTTCGAGTGA TGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 TACCGCATATCTGTGTACAT GGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 TGACTTGATTTGGCTGTGCA AGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 ATTGTGTTGTGCTAAACGCT GGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 CTTGATTTGGCTGTGCAAGG TGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 GAAGTTAATATTGACTGACC TGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 GTGGGCTTTTAACGTATTTA AGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 GATTCACGGGGTATAAATGT TGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 TTGGACTTAAGGGCATCATC AGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 TATTACCTTGGCCTAGGGGG TGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 TCCCTCCCTGTCGCTAACTC CGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 GTACCTTATAACGTTGGATT TGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 AAATATCCGCAGGGTCCCCC AGG CRISPRko Experimental validated 29932899
NEAT1 Homo sapiens chr11 CACCGTGTTATACTCGATTC CGG CRISPRko Experimental validated 29932899